View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16780_low_43 (Length: 299)

Name: NF16780_low_43
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16780_low_43
NF16780_low_43
[»] chr8 (1 HSPs)
chr8 (249-283)||(20515595-20515629)


Alignment Details
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 249 - 283
Target Start/End: Original strand, 20515595 - 20515629
Alignment:
249 agaagttgaatgattgaagatgcttccagagatga 283  Q
    |||||||||||||||||||||||||||||||||||    
20515595 agaagttgaatgattgaagatgcttccagagatga 20515629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University