View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_low_49 (Length: 273)
Name: NF16780_low_49
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 15 - 246
Target Start/End: Original strand, 4599807 - 4600036
Alignment:
| Q |
15 |
caaaggctacattaacaaaactggttcgtgagatacaccgtaagccaggatgtggagtgtgtatcttgagttggatgtggatgcatccaaaaggacaatt |
114 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4599807 |
caaaggctacaccaacaaaactggttcgtgagatacaccgtaagccaggatgtggagtgtgtatcttgagttggatgtggatgcatccaaaaggacaatt |
4599906 |
T |
 |
| Q |
115 |
cgtggatttaagaattaaccggttatttaaaag----atccacaacaataaatttttaagttgaaaaagaaagccctgaattattattatacaggaggga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
4599907 |
cgtggatttaagaattaaccggttatttaaaagatccatccacaacaataaa-ttttaagttgaaaaagaaagccctgaatta-tattataca----gga |
4600000 |
T |
 |
| Q |
211 |
gggggtaaacaaagttctccttaggtgcatctaaat |
246 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4600001 |
gggggtaaacaaagttctccataggtgcatctaaat |
4600036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University