View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_low_54 (Length: 257)
Name: NF16780_low_54
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_low_54 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 37 - 257
Target Start/End: Original strand, 36478092 - 36478312
Alignment:
| Q |
37 |
cttgaagaaatgatgtgaagattttgagtattgataatatggagattaatgattttttgaacaagctatggagattaatgattgaaatctttcctcaagn |
136 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36478092 |
cttgaagaaataatgtgaagattttgagtattgataatatggagattaatgattttttgaacaagctatggagattaatgattgaaatctttcctcaagt |
36478191 |
T |
|
| Q |
137 |
nnnnnncttccgatcaatggagataacttgatcccaattgccacccttattatatatttatttcttgagtttgattttttggttgaataattattcgtaa |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36478192 |
ttttttcttccgatcaatggagataacttgatcccaattgccacccttattatatatttatttcttgagtttgattttttggttgaataattattcgtaa |
36478291 |
T |
|
| Q |
237 |
gatttaactaatcttttacac |
257 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36478292 |
gatttaactaatcttttacac |
36478312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University