View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_low_58 (Length: 251)
Name: NF16780_low_58
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_low_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 174
Target Start/End: Complemental strand, 38770511 - 38770355
Alignment:
| Q |
18 |
accaaataccatcattattcataccaattgttcacaaggaatggagtagtataatctcaaattgaacttaaaaaattgaatgtcgttcatggtcttggaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38770511 |
accaaataccatcattattcataccaatagttcacaaggaatggagtagtataatctcaaattgaacttaaaaaattgaatgtcgttcatggtcttggaa |
38770412 |
T |
 |
| Q |
118 |
gatgaattataagtgtgtatataaatatatgctatcaattgcatgactgagtgtcat |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38770411 |
gatgaattataagtgtgtatataaatatatgctatcaattgcatgactgagtgtcat |
38770355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 211 - 240
Target Start/End: Complemental strand, 38770254 - 38770225
Alignment:
| Q |
211 |
tcttaatcttcttttgtctagtattttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38770254 |
tcttaatcttcttttgtctagtattttcat |
38770225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University