View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_low_65 (Length: 247)
Name: NF16780_low_65
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_low_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 63 - 231
Target Start/End: Original strand, 15632980 - 15633141
Alignment:
| Q |
63 |
ccctaacaaagatcacggcgaagaacatatggagcatgttctttcttcaaaataaacatactcgccaggttttgagcaacatccctcgtgatttctaaca |
162 |
Q |
| |
|
|||||||||||||||||||||||||||| || | ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15632980 |
ccctaacaaagatcacggcgaagaacat-----gcttc--ctttcttcaaaataaacatacccgcaaggttttgagcaacatccctcgtgatttctaaca |
15633072 |
T |
 |
| Q |
163 |
atgggacataattcactgatcggaagtcccgagattatttaaaaaactaaaacatctaacaaagtttca |
231 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15633073 |
atgtgacataattcactgatcggaagtcccgagattatttaaaaaactaaaacatctaacaaagtttca |
15633141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University