View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16780_low_66 (Length: 243)

Name: NF16780_low_66
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16780_low_66
NF16780_low_66
[»] scaffold0223 (1 HSPs)
scaffold0223 (26-224)||(11429-11627)


Alignment Details
Target: scaffold0223 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 26 - 224
Target Start/End: Complemental strand, 11627 - 11429
Alignment:
26 cctccatactgccactaactccgcctcctccatgtcgccgccggaatccccctccctccatccccatcacatcctcatcgtagcgctgtttttcgccgcc 125  Q
    ||||||||| |||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11627 cctccataccgccactaactccgccaactccatgtcgccgccggaatccccctccctccatccccatcacatcctcatcgtagcgctgtttttcgccgcc 11528  T
126 gtttctctctccaccttactcctctgcagagacgctgattactcttacttcgcttcctcttattccttccgttttccaaccgtttttccctccgcttcc 224  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11527 gtttctctctccaccttactcctcttcagagacgctgattactcttacttcgcttcctcttattccttccgttttccaaccgtttttccctccgcttcc 11429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University