View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_low_67 (Length: 240)
Name: NF16780_low_67
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 97 - 224
Target Start/End: Original strand, 30718099 - 30718226
Alignment:
| Q |
97 |
cctgattgagttgattcatggtgagatcaacggtgtggtgagagtgaagaagatgaatataatcttcgaggcagatcttctcgttctttgctggtcgctt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30718099 |
cctgattgagttgattcatggtgagatcaacggtgtggcgagagtgaagaagatgaatgtaatcttcgaggcagatcttctcgttctttgctggtcgctt |
30718198 |
T |
 |
| Q |
197 |
cttcgtggagattgcgtgtggtaccatt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
30718199 |
cttcgtggagattgcgtgtggtaccatt |
30718226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 97 - 224
Target Start/End: Complemental strand, 30894210 - 30894083
Alignment:
| Q |
97 |
cctgattgagttgattcatggtgagatcaacggtgtggtgagagtgaagaagatgaatataatcttcgaggcagatcttctcgttctttgctggtcgctt |
196 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| | ||||||||||||||||||| |||||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
30894210 |
cctgattgagttgattcatagtgagatcattggtgttgcgagagtgaagaagatgaatgtaatcttcgaggcagagcttttcgttctttgctgaacgctt |
30894111 |
T |
 |
| Q |
197 |
cttcgtggagattgcgtgtggtaccatt |
224 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
30894110 |
cttcgaggagattgcgtgtggtaccatt |
30894083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University