View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_low_72 (Length: 233)
Name: NF16780_low_72
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_low_72 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 121 - 216
Target Start/End: Original strand, 42396082 - 42396173
Alignment:
| Q |
121 |
ggtttttccaaatataattcattcattccacgcgcnnnnnnnngtaacttgtaagaatcttccctccataaaaggacaaatttaattagggtccta |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42396082 |
ggtttttccaaatataattcattc----cacgcgcttttttttgtaacttgtaagaatcttccctccataaaaagacaaatttaattagggtccta |
42396173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 23 - 65
Target Start/End: Original strand, 42396011 - 42396053
Alignment:
| Q |
23 |
tatattcttgcaaacagctagctgtccgtccaatgaaatgaaa |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42396011 |
tatattcttgcaaacagctagctgtccgtccaatgaaatgaaa |
42396053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University