View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_low_76 (Length: 223)
Name: NF16780_low_76
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_low_76 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 41 - 176
Target Start/End: Original strand, 1163360 - 1163495
Alignment:
| Q |
41 |
aaaaggacaacattttagagaagactttcaaagaggataccattttagaggataaaatgcaggataaccattgatacaaaaccaaactactaagattgtt |
140 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1163360 |
aaaaggacaacattttatagaagactttcaaagaggataccattttagaggataaaatgcaggataaccattgatacaaaaccaaactactaagattgtt |
1163459 |
T |
 |
| Q |
141 |
taatttaaagtccaaattgcatattacgctagtata |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1163460 |
taatttaaagtccaaattgcatattacgctagtata |
1163495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 205
Target Start/End: Original strand, 1163539 - 1163571
Alignment:
| Q |
173 |
tataataaagacattgtcattagaaggagatgg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1163539 |
tataataaagacattgtcattagaaggagatgg |
1163571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University