View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_low_81 (Length: 211)
Name: NF16780_low_81
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_low_81 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 38699720 - 38699542
Alignment:
| Q |
18 |
gattgttgtaaattgatgttgcaaaataaacgatggatctgaacaatgcaataaaaaatcatgacaacattttcttcattcgatgttggagaaggacctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
38699720 |
gattgttgtaaattgatgttgcaaaataaacgatggatctgaacaatgcaataaaaaatcatgacaatattttcttcaatcgatgttggagaaggacctt |
38699621 |
T |
 |
| Q |
118 |
tgctcttcttgtatgtaacctatccaacttaattatgctcaaaccctattccatcacatcagtttacttatgatttcat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38699620 |
tgctcttcttgtatgtaacctatccaacttaattatgctcaaaccctattccatcacatcagtttacttatgatttcat |
38699542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University