View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16780_low_84 (Length: 205)
Name: NF16780_low_84
Description: NF16780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16780_low_84 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 23 - 158
Target Start/End: Complemental strand, 41097706 - 41097571
Alignment:
| Q |
23 |
tcttccatagttgaacaaactttatcccaatgattccattgtattttgcaagattcctcacttctccataaaaatattttaaaagagattcaagaaaagt |
122 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
41097706 |
tcttccatagttgatcaaactttatcccaatgattccattgtattttgcaagattcctcacttccccataaaattattttaaaagagattcaaggaaagt |
41097607 |
T |
|
| Q |
123 |
aattatattcgtgggagccttgaagaagtaactata |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41097606 |
aattatattcgtgggagccttgaagaagtaactata |
41097571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University