View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16782_low_1 (Length: 454)
Name: NF16782_low_1
Description: NF16782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16782_low_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 65; Significance: 2e-28; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 173 - 270
Target Start/End: Complemental strand, 2962233 - 2962132
Alignment:
| Q |
173 |
ttttttctttagaaactaattcggccagctacatatttt----gtgagattaaaatctaacttcactccattttttaaattcatgtagagtgtgtctgat |
268 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
2962233 |
ttttttctttagaaactaattcggcctgctacatattttatgtgtgagattaaaatgaaacttcactccattttttaaattcatgtatagtgtgtttgat |
2962134 |
T |
 |
| Q |
269 |
gg |
270 |
Q |
| |
|
|| |
|
|
| T |
2962133 |
gg |
2962132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 2963002 - 2962956
Alignment:
| Q |
62 |
tgaagtttgaactaaagagacagttggattttgtatgacctgctttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2963002 |
tgaagtttgaactaaagagacagttggattttttatgacctgctttt |
2962956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 211
Target Start/End: Complemental strand, 2957670 - 2957632
Alignment:
| Q |
173 |
ttttttctttagaaactaattcggccagctacatatttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
2957670 |
ttttttctttagaaactaattcggcctgttacatatttt |
2957632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University