View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16783_high_13 (Length: 249)
Name: NF16783_high_13
Description: NF16783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16783_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 15 - 231
Target Start/End: Complemental strand, 40941411 - 40941199
Alignment:
| Q |
15 |
agcagagatctccaatatgtttgtaagttttaaaatgaaattggcttttgaaagnnnnnnn---tgagtataatcccctaatcccacagcgcccaaccaa |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
40941411 |
agcaaagatctccaatatgtttgtaagttttaaaatgaaattggcttttgaaaaagaaaaaaaatgagtataatccc--------acagcgcccaaccaa |
40941320 |
T |
 |
| Q |
112 |
ccatgaattgagcttcaaaatcaaaactctgttccga-caacccttatccccacaatcacgcaatgaatcgtcgatccctctcggtgaccaaacaaaacc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40941319 |
ccatgaattgagcttcaaaatcaaaactctgttcccaacaacccttatccccaaaatcatgcaatgaatcgtcgatccctctcggtgaccaaacaaaacc |
40941220 |
T |
 |
| Q |
211 |
ataaatgagaaacattgtagc |
231 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40941219 |
ataaatgagaaacattgtagc |
40941199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University