View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16783_high_14 (Length: 243)
Name: NF16783_high_14
Description: NF16783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16783_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 2 - 229
Target Start/End: Complemental strand, 3096892 - 3096665
Alignment:
| Q |
2 |
tatcagtcacgatatcacagatgaaattgtggtgaattcttaagatactaaaatcctctgctagtgataccaatcatgcacatctcgatgctatgtcaac |
101 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3096892 |
tatcagtcacgatatcacagatgaaactgtggtgaattcttaagatactaaaatcctctgctagtgataccaatcatgcacatctcgatgctatgtcaac |
3096793 |
T |
|
| Q |
102 |
aaacattacagtactatactactaagacttacgtcaatctgatcnnnnnnngcaatcttataccagtccttggcagccaccccagttctccactcaaaat |
201 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3096792 |
aaacattacactactattctactaagacttacgtcaatctgatctttttttgcaatcttataccagtccttggcagccaccccagttctccactcaaaat |
3096693 |
T |
|
| Q |
202 |
caatggtcacagttattgtgggtctctg |
229 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
3096692 |
caatggtcacagttattgtgggtttctg |
3096665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University