View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16783_high_6 (Length: 365)
Name: NF16783_high_6
Description: NF16783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16783_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 1 - 350
Target Start/End: Complemental strand, 14202674 - 14202325
Alignment:
| Q |
1 |
attgaaagttattaattatttgaacacaatcaattgataaataatttttacggtttatatgacacactagaatttctttaataaatttgcttagcacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14202674 |
attgaaagttattaattatttgaacacaatcaattgataaataatttttacggtttatatgacacactagaatttctttaataaatttgcttagcacaaa |
14202575 |
T |
 |
| Q |
101 |
aagtagaataaaagttggggaattgatgaattgtgtaaagacttttttcatttctctgccttcgaatacaggactaaaataaattttgaaatgagatatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| | |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14202574 |
aagtagaataaaagttggggaattgatgaattgtgcaaagacttttttcaatcctcttccttcgaatacaggactaaaataaattttgaaatgagatatt |
14202475 |
T |
 |
| Q |
201 |
ttaaaatagaatcagcactttgaaccaaaataggcagatagcttgagtgtttgaatttttcatgtcttttaacttttgatcatgtatgaaacatatattc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14202474 |
ttaaaatagaatcagcactttgaaccaaaataggcagatagcttgagtgtttgaatttttcatatcttttaacttttgatcatgtatgaaacatatattc |
14202375 |
T |
 |
| Q |
301 |
taggttattattaaagatgcatgcacaccttttaaatgtaactcaattat |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14202374 |
taggttattattaaagatgcatgcacaccttttaaatgtaactcaattat |
14202325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University