View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16783_low_21 (Length: 227)
Name: NF16783_low_21
Description: NF16783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16783_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 82 - 211
Target Start/End: Complemental strand, 394579 - 394451
Alignment:
| Q |
82 |
attcagaagttgaaattagctagaaatatatggtcactaatttttgaaagtctaagtaattaccagaatatatggcaagtnnnnnnnngataaatagatt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
394579 |
attcagaagttgaaattagctagaaatatatggtcactaatttttgaaagtctaagtaattaccagaatatatggcaagtaaaaaaagg-taaatagatt |
394481 |
T |
 |
| Q |
182 |
ttgttacattgagagttgggtgaattttgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
394480 |
ttgttacattgagagttgggtgaattttgt |
394451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 13 - 82
Target Start/End: Complemental strand, 394675 - 394606
Alignment:
| Q |
13 |
aaaggtaaaggaaatgcagtaatagaaaaatgaaacataaacttaccaagcttcatcacaagatgcttta |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
394675 |
aaaggtaaaggaaatgcagtaatagaaaaatgaaacataaactaaccaagcttcatcacaagatgcttta |
394606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University