View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16784_high_7 (Length: 311)
Name: NF16784_high_7
Description: NF16784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16784_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 217 - 294
Target Start/End: Complemental strand, 47560879 - 47560802
Alignment:
| Q |
217 |
cttcattagtctttcttatttgatagatctattctcaccgccattaattacaaactacaaacagatttcttgaccttt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47560879 |
cttcattagtctttcttatttgatagatctatcctcaccgacattaattacaaactacaaacagatttcttgaccttt |
47560802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 24 - 91
Target Start/End: Complemental strand, 47561045 - 47560978
Alignment:
| Q |
24 |
aaacacgcacgcgtacacacccttcctgcctcagttttttcactttgaatttgaaaggtaatttcttg |
91 |
Q |
| |
|
|||||| | |||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47561045 |
aaacacacgcgcgcacacacccttcttgcctcagtttttccactttgaatttgaaaggtaatttcttg |
47560978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 162 - 206
Target Start/End: Complemental strand, 47560907 - 47560863
Alignment:
| Q |
162 |
cgtcgtcgtcacagttgctttggacatccttcattagtctttctt |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47560907 |
cgtcgtcgtcacagttgcttcggacatccttcattagtctttctt |
47560863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University