View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16784_low_11 (Length: 238)

Name: NF16784_low_11
Description: NF16784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16784_low_11
NF16784_low_11
[»] chr5 (3 HSPs)
chr5 (139-238)||(19581528-19581627)
chr5 (139-238)||(19587605-19587704)
chr5 (24-91)||(19588263-19588330)


Alignment Details
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 139 - 238
Target Start/End: Original strand, 19581528 - 19581627
Alignment:
Q  139 ttagaaaaatcataattgcttagtggtgatatccctaaacctatttttctaaatatgaaacagttggttaatcacattaaaaaatgtggttaatgtagtt 238  Q
    |||||||||||||| ||| ||||||||||||||| |||||||||||| ||| || ||||||||||||||||  ||| |||||||||||||||||||||||    
T  19581528 ttagaaaaatcatatttgtttagtggtgatatccataaacctattttcctacatctgaaacagttggttaacgacagtaaaaaatgtggttaatgtagtt 19581627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 139 - 238
Target Start/End: Complemental strand, 19587704 - 19587605
Alignment:
Q  139 ttagaaaaatcataattgcttagtggtgatatccctaaacctatttttctaaatatgaaacagttggttaatcacattaaaaaatgtggttaatgtagtt 238  Q
    ||||||||||||||  || ||||||||||||||| |||||||||||| ||| |  ||||||||||||||||  ||| ||||||||| |||||||||||||    
T  19587704 ttagaaaaatcatatatgtttagtggtgatatccataaacctattttcctacaactgaaacagttggttaacgacagtaaaaaatgcggttaatgtagtt 19587605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 24 - 91
Target Start/End: Complemental strand, 19588330 - 19588263
Alignment:
Q  24 aaatttacttaaaatcccatttattattagggcatttgtcagcttgttttgcaagaaatcttataaaa 91  Q
    ||||||||||||||||| ||| ||||||||||||||||  ||||||||||||||||||||||||||||    
T  19588330 aaatttacttaaaatccaattcattattagggcatttgatagcttgttttgcaagaaatcttataaaa 19588263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University