View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16785_high_2 (Length: 311)
Name: NF16785_high_2
Description: NF16785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16785_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 24356950 - 24357242
Alignment:
| Q |
1 |
ttggtttactatgggcgatgacatggtcgtatcaagttacagatgatccttcggaaagcaatttcatcagcagatcagaactaagattgatccaagctgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
24356950 |
ttggtttactatgggcgatgacatggtcgtatcaagttacagatgatccttcggaaagcaattttatcaacagatcagaactaagattgatccaagctgg |
24357049 |
T |
|
| Q |
101 |
aaaaactgcttctccaaagaagagtaacaagcttcctcctataggccttattttatcaaaattgccatcatgggctataatatttgccaatgcaactaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24357050 |
aaaaactgcttctccaaagaagagtaacaagcttcctcctataggccttattttatcaaaattgccatcatgggctataatatttgccaatgcaactaac |
24357149 |
T |
|
| Q |
201 |
aattgggtgagttttatttgcttttgtgtgaagataagaacttgcttgatatcatgaatttaattttaagcatactgattttgaccttgttta |
293 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24357150 |
aattgggtgagttttatttgcttttgagtgaagataagaacttgcttgatatcatgaatttaattttaagcatactgattttgaccttgttta |
24357242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University