View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16785_low_7 (Length: 216)
Name: NF16785_low_7
Description: NF16785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16785_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 40399367 - 40399548
Alignment:
| Q |
16 |
aagaagaaggaatcggtcgaagttcgggaaccgagagtcgtgtccatcacaacaagaccgaagatctcatatcataacggatcatttaacgacttcactg |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40399367 |
aagaagaaggaatcggtcgaagttcggcaaccgagagtcgtgtccatcacaacaagaccgaagatctcatatcataacggatcatttaacgatttcactg |
40399466 |
T |
|
| Q |
116 |
aggatgttgacctcattcccctttggtggaaaatatctctaatttagaattgttacaaagaaagtatttctctccaaaatca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40399467 |
aggatgttgacctcattcccctttggtggaaaatatctctaatttagaattgttacaaagaaagtatttctctccaaaatca |
40399548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University