View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16786_high_1 (Length: 327)
Name: NF16786_high_1
Description: NF16786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16786_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 267
Target Start/End: Original strand, 42934806 - 42935038
Alignment:
| Q |
20 |
ataggcaaggcagtaataaaagaataggcagaggactgcattgattggaaaggtgtagcagcaatttgtttattctttcaaattagcttaagattgcaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42934806 |
ataggcaaggcagtaataaaagaataggcagaggactgcattgattggaaaggtgtagcagc--tttgtttattctttcaaattagcttaagattgcaga |
42934903 |
T |
|
| Q |
120 |
atttttcttgctggtttttctagttgttaattagacttagattggcactagatgtgtccaaactttagactagtatttttcttttgtaagacatagattt |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42934904 |
atttt-------------tctagttgttaattagacttagattggcactagatgtgtccaaactttagactagtatttttcttttgtaagacatagattt |
42934990 |
T |
|
| Q |
220 |
cagaatttttcttgctctttcctattgcatctacgttattgattggag |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42934991 |
cagaatttttcttgctctttcctattgcatctacgttattgattggag |
42935038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 284 - 322
Target Start/End: Original strand, 42935061 - 42935099
Alignment:
| Q |
284 |
cggcttcaacaacgtttatttccgatttttcatttctct |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935061 |
cggcttcaacaacgtttatttccgatttttcatttctct |
42935099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University