View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16786_low_3 (Length: 249)
Name: NF16786_low_3
Description: NF16786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16786_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 234
Target Start/End: Complemental strand, 36440655 - 36440436
Alignment:
| Q |
16 |
caaaggccgacgataaaacttgatcgatgacttgtcgtgggctcgtaatttaacacgtagtgaaattgaaaaccaccaaatacttgtgttttttccc-at |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36440655 |
caaaggccgacgataaaacttgatcgatgacttgtcgtgggctcgtaatttaacacgtagtgaaattgaaaaccaccaaatacttgtgttttttccccat |
36440556 |
T |
|
| Q |
115 |
ataaataacatttgtattttgctaaaagaagtattccacgtgatatcaattctatgaaatatgaagtaggtgatttaagagagatatagtgtgtccaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36440555 |
ataaataacatttgtattttgctaaaagaagtattccacgtgatatcaattctatgaaatatgaagtaggtgatttaagagagatatagtgtgtccaaaa |
36440456 |
T |
|
| Q |
215 |
tagttttttacaaactaaat |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
36440455 |
tagttttttacaaactaaat |
36440436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University