View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16788_low_3 (Length: 339)
Name: NF16788_low_3
Description: NF16788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16788_low_3 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 162 - 339
Target Start/End: Original strand, 35375043 - 35375220
Alignment:
| Q |
162 |
aaatcaaataggataccaatttatttcggcactttatgttatcaacttcatgaatgtttgtatgtatatttctctatttgcatgcaccttaggaatggta |
261 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35375043 |
aaatcaaataggataccaatttatttgggcactttatgttatcaacttcatgaatgtttttatgtatatttctctatttgcatgcaccttaggaatggta |
35375142 |
T |
|
| Q |
262 |
ctggtattatctatttgcaatttctaacatagcattagtactagtacaagaaatttcgttcataaattgtatgacatt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35375143 |
ctggtattatctatttgcaatttctaacatagcattagtactagtacaagaaatttcgttcataaattgtatgacatt |
35375220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 35374900 - 35374958
Alignment:
| Q |
19 |
tctataattatagatgtgccggagagatcacccctcactcccccctaactttgaaaaag |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||||| ||||| |
|
|
| T |
35374900 |
tctataattatagatgtgccggagagatcactcctcactccccggtaactttggaaaag |
35374958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University