View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16790_low_11 (Length: 415)
Name: NF16790_low_11
Description: NF16790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16790_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 19 - 397
Target Start/End: Complemental strand, 54609835 - 54609462
Alignment:
| Q |
19 |
ggttttaacataagttagcattagcactagaattctgtaacttcttatagacacaacataa----gacttggtagataattaagtatttattactttaaa |
114 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
54609835 |
ggttttaacataagttaggattagcactagaattctgtaacttcttatagacacaacatatataggacttggtagataa----gtatttattactttaaa |
54609740 |
T |
 |
| Q |
115 |
ctcaaagacattatgtatggtaatcataattaattcattatcttcatctcatcctatctcactttttggttggtataactgaacatttcaccagcatgtc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54609739 |
ctcaaagacattatgtatggtaatcataattaattcattatcttcatctcatcttatctcactttttggttggtataactgaacatttcaccagcatgtc |
54609640 |
T |
 |
| Q |
215 |
acaacatcaattgtctagaagtgttaatcattatgtttgttggaacgtacgtgtaatgcagtttctaagtatacattgttatccttttcatacgaaacga |
314 |
Q |
| |
|
||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54609639 |
acagcatcaattgtctagaagtgtcaatcattatgtttgttggcacgtacgtgtaatgcagtttctaagtatacattgttatccttttcatacgaaac-- |
54609542 |
T |
 |
| Q |
315 |
aactttgcagatacaattgcgatagaaacctcgtaaaatatatggtcaaattttatggggaagatgctttgaaataagttaaa |
397 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54609541 |
---tctgcagatacaattgcgatagaaacctcgtaaaatatatggtcaaattttatggggaagatgctttgaaataagttaaa |
54609462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University