View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16790_low_14 (Length: 335)
Name: NF16790_low_14
Description: NF16790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16790_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 331
Target Start/End: Original strand, 43466077 - 43466382
Alignment:
| Q |
19 |
gggtgcactactaacgtggataggagaactactgaggaggctagtattcttttcatgatgttgaattattgtcaccttttaaggttggtaattctgcata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43466077 |
gggtgcactactaacgtggataggagaactactggggaggctagtgttcttttcatgatgttgaattattgtcaccttttaaggttggtaattctgcata |
43466176 |
T |
 |
| Q |
119 |
acctacttaagcgtaaagtgattactgatcctagtggcacctcttgtgcattttgtggtgcttccatgtagtcgttttaggtggttatgttggagtttgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43466177 |
acctacttaagcgtaaagtgattactgatcctagtggcacctcttgtgcaatttgtggtgcttccatgtagtcgttttaggtggttatgttggagtttgt |
43466276 |
T |
 |
| Q |
219 |
ctccacgggatgtggtggctatctttgtcttttttccaaggtccagaagttggttgtagagattggtttggactttggtatctattttgttttgcatgtt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||||||| |
|
|
| T |
43466277 |
ctccacgggatgtggtggctatctttgtcttttttccaaggtccagaagttggttgtagagattgg-------tttcgtatgtattttgttttgcatgtt |
43466369 |
T |
 |
| Q |
319 |
tttctgtgctcct |
331 |
Q |
| |
|
||| |||| |||| |
|
|
| T |
43466370 |
tttgtgtggtcct |
43466382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University