View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16790_low_22 (Length: 242)
Name: NF16790_low_22
Description: NF16790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16790_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 40313110 - 40313317
Alignment:
| Q |
16 |
aagaaacaaaaagtactttcaccatttccttattatgatgaaaagcatatatcattttcagcacactgatggatcattttgggacgtagaagaccaacga |
115 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40313110 |
aagaaacaaatagtactttcaccatttccttattatgatgaaaagcatatatcattttcagcacactgatggaccattttgggacgtagaagaccaacga |
40313209 |
T |
|
| Q |
116 |
caaaagcttcttaatccatatggattcggcaacaacacatgttccttaaattaatatcaatttcacatatctgccctacaagtctacaaacatgttgtaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40313210 |
caaaagcttcttaatccatatggattcggcaacaacacatgttccttaaattaatatcaatttcacatatctgccctacaagtctacaaacatgttgtaa |
40313309 |
T |
|
| Q |
216 |
gctttcaa |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
40313310 |
gctttcaa |
40313317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University