View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16790_low_23 (Length: 240)
Name: NF16790_low_23
Description: NF16790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16790_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 24607237 - 24607011
Alignment:
| Q |
1 |
gatcttcggggtttgttattcgacggtgaaacacctgatatgccaaagatagctggtgaatacatcttagagtacgtattccaaataactgtgactagat |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24607237 |
gatcttaggggtttgttattcgacggtgaaacacctgatatgccaaagatagctggcgaatacatcttagagtacgtattccaaatcactgtgactagat |
24607138 |
T |
|
| Q |
101 |
caaaatggatagatttatcggtcatcttaagcatgattatcatataccgcattatcttcttcgtcatgatcaaggtcaatgaggatgttactccatgggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24607137 |
caaaatggatagatttatcggtcatcttaagcatgattatcatataccgcattatcttcttcgtcatgatcaaggtcaatgaggatgttactccatgggt |
24607038 |
T |
|
| Q |
201 |
tagagggtatcttgctaggagaagaat |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
24607037 |
tagagggtatcttgctaggagaagaat |
24607011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University