View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16791_high_18 (Length: 330)
Name: NF16791_high_18
Description: NF16791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16791_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 50883556 - 50883704
Alignment:
| Q |
1 |
acacaaagagtgaggcaccatgataaacaatttgtgtgttagataatacgtaatgagattttagttgtaattgtgttaagagtagttgtgtttattaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50883556 |
acacaaagagtgaggcaccatgataaacaatttgtgtgttagataatacgtaatgagattttagttgtaattgtgttaagagtagttgtgtttattaata |
50883655 |
T |
|
| Q |
101 |
tttcactatttatcagtagagtaaatattttgtattctaaattttgctc |
149 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50883656 |
tttcactatttattagtagagtaaatattttgtattctaaattttgctc |
50883704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 211 - 316
Target Start/End: Original strand, 50883766 - 50883871
Alignment:
| Q |
211 |
gagctctctttgttcgtatattgatcctttctctttgattgttttatcttgagttgatcctttttcagttgatttatgtttgatttagttcaattcgatt |
310 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||| ||||||||||||| |
|
|
| T |
50883766 |
gagctctctttatttgtatattgatcctttctctttgattgttttgtcttgagttgatcctttctcggttgatttatgtttgatttggttcaattcgatt |
50883865 |
T |
|
| Q |
311 |
catctc |
316 |
Q |
| |
|
|||||| |
|
|
| T |
50883866 |
catctc |
50883871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University