View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16791_high_20 (Length: 304)
Name: NF16791_high_20
Description: NF16791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16791_high_20 |
 |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0027 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 27 - 304
Target Start/End: Complemental strand, 47314 - 47037
Alignment:
| Q |
27 |
agaatttcactataaattatcatggtacatggttgcatgcataaataaccaataataaactattgcaaatgatatttgacccaagtaagggcacaagcaa |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47314 |
agaatttcactataaattatcatggtacatggttgcatgcatatttaaccaatactaaactattgcaaatgatatttgacccaagtaagggcacaagcaa |
47215 |
T |
 |
| Q |
127 |
tgaaatcaacatattgtgggtttggttggaagttgagccaaccgttgaatattgcaatctacttttattccttttgcttctttttgtcattacacatcac |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47214 |
tgaaatcaacatattgtgggtttggttggaagttgagccaaccgttgaatattgcaatctacttttattccttttgcttctttttgtcattacacatcac |
47115 |
T |
 |
| Q |
227 |
actttggatgctcctcactaccatccaatttgatatactttaaattggttcctctttatttactttgttacacaaaac |
304 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47114 |
actttgggtgctcctcactaccatccaatttgatatactttaaattggttcctctttgtttactttgttacacaaaac |
47037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University