View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16791_high_33 (Length: 204)
Name: NF16791_high_33
Description: NF16791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16791_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 22 - 187
Target Start/End: Complemental strand, 42444678 - 42444513
Alignment:
| Q |
22 |
tttaaaggccagatttgagtatgaaggttgttgttgttgttcaaggcggtggaggatcagtggagcctctttgtgaaaattagagcattttctcctttct |
121 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| | |||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42444678 |
tttaaaggccagatttaagtatgaaggttgttgttgttgttcacgacggtgggagatgagtggagcctctttgtgaaaattagagcattttctcctttct |
42444579 |
T |
 |
| Q |
122 |
gtgaatagtggggatgaatgggttcagatttgggttaagaatgaggagaagccactcatctgaaaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42444578 |
gtgaatagtggggatgaatgggttcatatttgggttaagaatgaggagaaaccactcatctgaaaa |
42444513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 13 - 184
Target Start/End: Original strand, 15603473 - 15603640
Alignment:
| Q |
13 |
agagaagaatttaaaggccagatttgagtatgaaggttgttgttgttgttcaaggcggtggaggatcagtggagcctctttgtgaaaattagagcatttt |
112 |
Q |
| |
|
|||||||| ||||||||||| ||||| |||||||||||||||||||| | || ||||| |||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
15603473 |
agagaagagtttaaaggccatatttgtgtatgaaggttgttgttgttt---acggtggtgggggatgagtggagcatctttgtgaaaattagagcctttt |
15603569 |
T |
 |
| Q |
113 |
ctcctttctgtgaatagtggggatgaatgggttcagatttgggttaagaatgaggagaagccactcatctga |
184 |
Q |
| |
|
|||||| ||||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15603570 |
ctcctt-ctgtgaataatggggatgaatgagttcagatttgggttaagaatgaggagaaaacactcatctga |
15603640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University