View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16791_low_14 (Length: 346)
Name: NF16791_low_14
Description: NF16791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16791_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 32 - 326
Target Start/End: Original strand, 9961295 - 9961589
Alignment:
| Q |
32 |
attattctcattatcacatcacattttacttaatcttaaaaggtgaatttgagtttataaataaactcttgattaccacttacttatttgttgtcgttgt |
131 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9961295 |
attattctcattatcacaacacattttacttaatcttaaaaggtgaatttgagtttataaataaactcttgattaccacttacttatttgttgtcgttgt |
9961394 |
T |
 |
| Q |
132 |
gtataatattgcgcctactcaactagtcatgtgcttacatggttagttgtctgtttgcttgattcatcgtttgcctcgatgattagacgttgtttatcag |
231 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
9961395 |
gtataatattgcgcttactcaactagtcatgtgcttacatggttagttgtctgtttgcttgattcatcgtttgcccctatgattagacgttgtttatcag |
9961494 |
T |
 |
| Q |
232 |
ctacaggttcctaaactactctagagagtgtttaatgtcgaagtttgcatgaaaggtgaaggaaaaataactaagaaacttataggcttcaactt |
326 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9961495 |
ctacaagttcctaaactactctagagagtgtttaatgtcgaagtttgcatgaaaggtgaaggaaaaataactaagaaacttataggcttcaactt |
9961589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University