View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16791_low_16 (Length: 337)
Name: NF16791_low_16
Description: NF16791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16791_low_16 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 66 - 337
Target Start/End: Original strand, 36523219 - 36523488
Alignment:
| Q |
66 |
cgagaaagcaatgagtactacgtgttagcattttaaacnnnnnnnntgtgagttggtgtttacggaaaacacggtgaggtggccaatataaaagttttgc |
165 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36523219 |
cgagaaagcaatgagta--acgtgttagcattttaaacaaaaaaaatttgagttggtgtttacggaaaacacggtgaggtggccaagataaaagttttgc |
36523316 |
T |
 |
| Q |
166 |
ttggctttgtgaatgaaacattaaatctgaatataatacttttcttaacgatcaaaagccatcatcatgaattcatggccaaatgatcttcacgtcgatt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36523317 |
ttggctttgtgaatgaaacattaaatctgaatataatacttttcttaacgatcaaaagccgtaatcatgaattcatggccaaatgatcttcacgtcgatt |
36523416 |
T |
 |
| Q |
266 |
ccctccgtttagaggctggaagggtttcctcagctaataacatccatgcatccaaggtttgtatattactct |
337 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36523417 |
ccctccgtttagaggctggaagggttccctcagctaataacatccatgcatccaaggtttgtatgttactct |
36523488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 36523160 - 36523198
Alignment:
| Q |
1 |
caagtaggtattatttgcttgcacgatttaatgatgaag |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36523160 |
caagtaggtattatttgcttgcacgatttaatgatgaag |
36523198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University