View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16791_low_23 (Length: 297)
Name: NF16791_low_23
Description: NF16791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16791_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 107 - 280
Target Start/End: Original strand, 40824996 - 40825169
Alignment:
| Q |
107 |
acaaccacatttattcaatccaaaaggttagaaccccataccttgcttaaggggatagtcaaattccactcggaccaatgtaatgctggcaggcgtcaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40824996 |
acaaccacatttattcaatccaaaaggttagaaccccataccttgcttaaggggatagtcaaattccactcggaccaatgtaatgctggcaggcgtcaaa |
40825095 |
T |
|
| Q |
207 |
taatttggtcttgaaattaacgaaattccacattgataatcctcaatcacatcagtcctttggatggtcaatct |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40825096 |
taatttggtcttgaaattaacgaaattccacattgataatcctcaatcacatcagtcctttggatggtcaatct |
40825169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 40824884 - 40824967
Alignment:
| Q |
1 |
gtatccatgtcattgatgtgaagtattcatcaactttgccgatgagtcgatgactgatccccgttggggaatatggttggccac |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40824884 |
gtatccatgtcattgatgtgaagtattcatcaactttgccgatgagtcgatgactgatccccgttggggaatatggttggccac |
40824967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University