View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16791_low_28 (Length: 244)
Name: NF16791_low_28
Description: NF16791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16791_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 233
Target Start/End: Original strand, 8732569 - 8732786
Alignment:
| Q |
16 |
catctccaacaaacataacattatgcaacttatttccaatctccactttttcatggtacactcctgcttttacatgaataactgctcttgaaggacgatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8732569 |
catctccaacaaacataacattatgcaacttcttttcaatctccactttttcatggtacactcctgcttttacatgaataactgctcttgaaggacgatt |
8732668 |
T |
 |
| Q |
116 |
atgacccattgaagcaagtgcatccactgcttctttgattgttctatgacttcctgaaccatcttgcgccactgtgaagtctgctctatggtttgctaga |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8732669 |
atgtcccattgaagcaagtgcatccactgcttctttgattgttctatgacttcctgaaccatcttgtgccactgtgaagtctgctctatggtttgctaga |
8732768 |
T |
 |
| Q |
216 |
ctccatgaatctagtagt |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
8732769 |
ctccatgaatctagtagt |
8732786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University