View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16791_low_30 (Length: 241)
Name: NF16791_low_30
Description: NF16791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16791_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 119 - 227
Target Start/End: Original strand, 36800761 - 36800871
Alignment:
| Q |
119 |
attgaattgaattcaatgcaaccaagtaaaa-gacaaggtttcttttcctgttattactccttttatcaaac-ttctctctcatatatggcactcacaat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36800761 |
attgaattgaattcaatgcaaccaagtaaaaagacaaggtttcttttcctgttattactccttttatcaaactttctctctcatatatggcactcacaat |
36800860 |
T |
 |
| Q |
217 |
tagatgatttt |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
36800861 |
tagatgatttt |
36800871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University