View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16791_low_30 (Length: 241)

Name: NF16791_low_30
Description: NF16791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16791_low_30
NF16791_low_30
[»] chr7 (1 HSPs)
chr7 (119-227)||(36800761-36800871)


Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 119 - 227
Target Start/End: Original strand, 36800761 - 36800871
Alignment:
119 attgaattgaattcaatgcaaccaagtaaaa-gacaaggtttcttttcctgttattactccttttatcaaac-ttctctctcatatatggcactcacaat 216  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
36800761 attgaattgaattcaatgcaaccaagtaaaaagacaaggtttcttttcctgttattactccttttatcaaactttctctctcatatatggcactcacaat 36800860  T
217 tagatgatttt 227  Q
    |||||||||||    
36800861 tagatgatttt 36800871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University