View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16791_low_33 (Length: 231)
Name: NF16791_low_33
Description: NF16791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16791_low_33 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 95 - 231
Target Start/End: Original strand, 36800462 - 36800598
Alignment:
| Q |
95 |
ggtggtgggagtggttctagttgagtagtggtttggtttggtttttcaacactggaagccatatatatataacnnnnnnncaacctaaaaactttgtctc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36800462 |
ggtggtgggagtggttctagttgagtagtggtttggtttggtttttcaacactggaagccatatatatataacaaaaaaacaacctaaaaactttgtctc |
36800561 |
T |
 |
| Q |
195 |
ttactcttgttttttaagtagtagtagtaaactcttt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36800562 |
ttactcttgttttttaagtagtagtagtaaactcttt |
36800598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University