View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16792_high_21 (Length: 242)
Name: NF16792_high_21
Description: NF16792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16792_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 2534482 - 2534240
Alignment:
| Q |
1 |
agtatttcagaatttcttgtgtgggtgatggttattgcctaacacagcatacgtttaaagtgatcaggtggcattggcattacacctgaaagttttactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2534482 |
agtatttcagaatttcttgtgtgggtgatggttattgcctaacacagcatacgtttaaagtgatcaggtggcattggcattacacctgaaagttttactt |
2534383 |
T |
 |
| Q |
101 |
tttctaaacaca--aaatgacattgcatatttccctaaccaaatcaaacttgctcacaaattctcagtggtaatttccaaagttatatgtggattgtgat |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2534382 |
tttctaaacacacaaaatgacattgcatatttccctaaccaaataaaacttgctcacaaattctcagtggtaatttccaaagttatatgtggattgtgat |
2534283 |
T |
 |
| Q |
199 |
tacagtttgttgctttctcaaatttaatctaaaactgcctttg |
241 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2534282 |
tacagtttgttgctttttcaaatttaatctaaaactgcctttg |
2534240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University