View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16792_low_14 (Length: 309)
Name: NF16792_low_14
Description: NF16792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16792_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 141 - 302
Target Start/End: Complemental strand, 36545301 - 36545140
Alignment:
| Q |
141 |
taataaaaggagaaagagagagagaaccatatattaatgttgataatgaggagaatgcaaatgattcttctattccatgtagcatgaaattcagtgagac |
240 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36545301 |
taataaaaggagaaagagagacagaaccatatattaaggttgataatgaggagaatgcaaatgattcttctattccatgtagcatgaaattcagtgagac |
36545202 |
T |
 |
| Q |
241 |
agtgtgtgcgtaacgttggatttgtaccaaaacattataacagcggtttcatttcatctcac |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36545201 |
agtgtgtgcgtaacgttggatttgtaccaaaacattataacagcggtttcatttcatttcac |
36545140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University