View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16792_low_18 (Length: 259)
Name: NF16792_low_18
Description: NF16792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16792_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 40 - 250
Target Start/End: Original strand, 48706057 - 48706266
Alignment:
| Q |
40 |
ataatgacaagagatgcatgggaggttgcggtagggacgatgatgttaatcatttgttcattcgttgcgatattttgggaagatttggtatttactctct |
139 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||| ||| |||||| |
|
|
| T |
48706057 |
ataatgacaagagacgcatgggaggttgaggtagggacgatgatgttaatcatttgttcgttcgttgcaattttttgggaagatttggtctttgctctct |
48706156 |
T |
 |
| Q |
140 |
ctttggttaggatgtgtcacggcaggtctagactctatatcaaaacattttgctcattttacttctctcacaaggttctctaagaaccttcgcaaaatta |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48706157 |
ctttggttaggatgtgtcacggcaggtctagactctatatcagaacattttgctcattttacttctctcac-aggttctctaagaaccttcgcaaaatta |
48706255 |
T |
 |
| Q |
240 |
tgcatattctt |
250 |
Q |
| |
|
||||||||||| |
|
|
| T |
48706256 |
tgcatattctt |
48706266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 141 - 230
Target Start/End: Original strand, 27163176 - 27163263
Alignment:
| Q |
141 |
tttggttaggatgtgtcacggcaggtctagactctatatcaaaacattttgctcattttacttctctcacaaggttctctaagaaccttc |
230 |
Q |
| |
|
|||||||||| || ||||| || |||||| |||||||||| | |||||||||||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
27163176 |
tttggttagggtgcgtcacaacaagtctaggctctatatcagatcattttgctcatttta--tctctcacaagtttctctaagaatcttc |
27163263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University