View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16792_low_25 (Length: 237)
Name: NF16792_low_25
Description: NF16792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16792_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 51310606 - 51310703
Alignment:
| Q |
1 |
gagccggaacggtggaggagacggagaccgtgacggagggctcttactattctgtctgatattggttggctgtgtttgaaacgatagggacggggacg |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310606 |
gagccggaacggtggaggagacggagaccgtgacggagggctcttactattctgtctgatattggttggctgtgtttgaaacgatagggacggggacg |
51310703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 149 - 222
Target Start/End: Original strand, 51310748 - 51310821
Alignment:
| Q |
149 |
aggcaacagactccatttccaaagaatgaggaacggttttgtgtgaagaatatagttttttggataagaatatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310748 |
aggcaacagactccatttccaaagaatgaggaacggttttgtgtgaagaatatagttttttggataagaatatg |
51310821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University