View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16792_low_30 (Length: 230)
Name: NF16792_low_30
Description: NF16792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16792_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 12 - 212
Target Start/End: Original strand, 4787397 - 4787597
Alignment:
| Q |
12 |
agaagcaaaggggcacgtcatggggaatggagggttatatgcatatcaaaaggaacactaataaagagtatggggtgtgtgcaatcaatgaatgggcata |
111 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4787397 |
agaaccaatggggcacgtcatggggaatggagggttatatgcatatcaaaaggaacactaataaagagtatggggtgtgtgcaatcaatgaatgggcata |
4787496 |
T |
|
| Q |
112 |
taatccagtcaaatataattgaacgaagcattagttccattttatagatcaagaataaattacggtttaatgcttctaggttttgtttgtgtgggtaatc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4787497 |
taatccagtcaaatataattgaacgaagcattagttccattttatagatcaagaataaattacggtttaatgcttctaggttttgtttgtgtgggtaatc |
4787596 |
T |
|
| Q |
212 |
t |
212 |
Q |
| |
|
| |
|
|
| T |
4787597 |
t |
4787597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 12 - 130
Target Start/End: Original strand, 4782651 - 4782769
Alignment:
| Q |
12 |
agaagcaaaggggcacgtcatggggaatggagggttatatgcatatcaaaaggaacactaataaagagtatggggtgtgtgcaatcaatgaatgggcata |
111 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| || ||| |||||| || |
|
|
| T |
4782651 |
agaaccaatggggcacgtcatggggaatggagggttatatgcatatcaaaaggaacacaaataaaaagtatggggtgtgtgctataaattcatgggctta |
4782750 |
T |
|
| Q |
112 |
taatccagtcaaatataat |
130 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4782751 |
taatccagtcaaatataat |
4782769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University