View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16792_low_32 (Length: 219)
Name: NF16792_low_32
Description: NF16792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16792_low_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 4 - 201
Target Start/End: Original strand, 4825131 - 4825328
Alignment:
| Q |
4 |
aaaccaagttcaatatatcttcttcgaagcaagaatcgacaaaaccaacacttgcattgaagaaatttggtctgattcttgtatcagtaccaacagccta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
4825131 |
aaaccaagttcaatatatcttcttcgaagcaagaatcgccaaaaccaacacttgcactgaagaaatttggtccgattcttgtatcaataccaacagccta |
4825230 |
T |
 |
| Q |
104 |
aaaaacttggttaacaaataaagtcacagatgaaattctttgagctgagaaagcattagctgctaacttggaatgttcagctgaacaaagatttcagc |
201 |
Q |
| |
|
| ||||||||||||||| | | | ||||||||||| |||| ||| |||||| |||| |||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
4825231 |
agaaacttggttaacaactgcattgacagatgaaatattttgggctaagaaagtattaactgctaacttagaatgttcagctgaccaaagatttcagc |
4825328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University