View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16793_low_31 (Length: 246)
Name: NF16793_low_31
Description: NF16793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16793_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 6915861 - 6916086
Alignment:
| Q |
1 |
aacaatcatttctggaatgggagaactacacttagatatttatgttaaatgcattaagatggagtatggggttgatgctacagttggaaagccccgggta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6915861 |
aacaatcatttctggaatgggagaactacacttagatatttatgttaaacgcattaagatggagtatggggttgatgctacagttggaaagccccgggta |
6915960 |
T |
|
| Q |
101 |
aacttcagagaaactgttactcaacgtgctgattttgattatttacataagaagcaatctggaggacaaggacaatatggacgagtgattggatatattg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6915961 |
aacttcagagaaactgttactcaacgtgctgattttgattatttacataagaagcaatctggagggcaaggacaatatggacgagtgattggatatattg |
6916060 |
T |
|
| Q |
201 |
aaccacttcctgctgggtcaggaact |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6916061 |
aaccacttcctgctgggtcaggaact |
6916086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 70 - 192
Target Start/End: Complemental strand, 15039391 - 15039269
Alignment:
| Q |
70 |
ggttgatgctacagttggaaagccccgggtaaacttcagagaaactgttactcaacgtgctgattttgattatttacataagaagcaatctggaggacaa |
169 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
15039391 |
ggttgatgctacagttggaaagccccgtgtaaacttcagagaaactgttactcaacgtgctgattttgattatttacataagaagcaatccggagggcaa |
15039292 |
T |
|
| Q |
170 |
ggacaatatggacgagtgattgg |
192 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
15039291 |
ggacaatatggacgggtgattgg |
15039269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 2 - 56
Target Start/End: Complemental strand, 15039977 - 15039923
Alignment:
| Q |
2 |
acaatcatttctggaatgggagaactacacttagatatttatgttaaatgcatta |
56 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| |||||| || |||||| |
|
|
| T |
15039977 |
acaattatttctggaatgggagaactgcacttagatatctatgttgaacgcatta |
15039923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University