View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16793_low_32 (Length: 235)
Name: NF16793_low_32
Description: NF16793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16793_low_32 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 215
Target Start/End: Complemental strand, 16422355 - 16422154
Alignment:
| Q |
14 |
agaagcataggtaaatgtaaacaacaccgcattaacaccaaatactnnnnnnnctatatctaaagttaccaatcttccagaagtgacatcagcttaagtc |
113 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16422355 |
agaaacataagtaaatgtaaacaacaccgcattaataccaaatactaaaaaaactatatctaaagttaccaatcttccagaagtgacatcaacttaagtc |
16422256 |
T |
|
| Q |
114 |
aactctttcgcaagtagatgagtgaactttgtgggaagataatctgcatttgatccataccgaaagaatgaatttcggtagtcttgtgcattatgttctt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16422255 |
aactctttcgcaagtagatgagtgaactttgtgggaagataatctgcatttgatccataccgaaagaatgaatttcggtagtcttgtgcattatgttctt |
16422156 |
T |
|
| Q |
214 |
gt |
215 |
Q |
| |
|
|| |
|
|
| T |
16422155 |
gt |
16422154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University