View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16793_low_33 (Length: 215)
Name: NF16793_low_33
Description: NF16793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16793_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 72 - 200
Target Start/End: Complemental strand, 40826977 - 40826849
Alignment:
| Q |
72 |
tatcagtgcttaataatacgcaagaaaaatatatggtcaatttgcaattacatatatcacaaaatcgggaattagggtccctcatttcattttgatttgt |
171 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40826977 |
tatcagtgcttaataatacgtaagaaaaatatatggtcaatttgcaattacatgtatcacaaaatcgggaattagggtccctcatttcattttgatttgt |
40826878 |
T |
 |
| Q |
172 |
gcggtcacactcgtggacaatatacaaat |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
40826877 |
gcggtaacactcgtggacaatatacaaat |
40826849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University