View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16793_low_35 (Length: 202)
Name: NF16793_low_35
Description: NF16793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16793_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 16 - 184
Target Start/End: Original strand, 13797813 - 13797981
Alignment:
| Q |
16 |
actactaataaagtacatgtattacaacattaattagtcatgatcactgtccaaccaaacctttaacttgaacctgatcttttctcttttcagctatgaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13797813 |
actactaataaagtacatgtattacaacattaattagtcatgatcactgtccaaccaaacctttaacttgaacctgatcttttctcttttctgctatgaa |
13797912 |
T |
 |
| Q |
116 |
tcttgaagcagcttcattacaagtaagatcttcaacatttgtgtgcaccactttggtaacagtagtagc |
184 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13797913 |
tcttgaagcagcttcattgcaagtaagatcttcaacatttgtgtgcaccactttggtaacagtagtagc |
13797981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University