View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16795_low_11 (Length: 243)
Name: NF16795_low_11
Description: NF16795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16795_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 39656400 - 39656175
Alignment:
| Q |
1 |
acctgatttcagcacaagttcttaacttttagtaatttttgtctttttgatttcaattctgtaatttgatacacaacaatttccagtattaattatcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39656400 |
acctgatttcagcacaagttcttaacttttagtaatttttgtcttttttatttcaattctgtaatttgatacacaacaatttccagtattaattatcttt |
39656301 |
T |
 |
| Q |
101 |
tattaattggatctcagaacatatcacaaaatgcaaatgagtctagtactccatttagtggaaatactcaactctcattagatgatatcaaacacttgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39656300 |
tattaattggatctcagaacatatcacaaaatgcaaatgagtctagtactccatttagtggaaatactcaactctcattagatgatatcaaacacttgct |
39656201 |
T |
 |
| Q |
201 |
tctctgaatggaatacatgagtattt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39656200 |
tctctgaatggaatacatgagtattt |
39656175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 111 - 191
Target Start/End: Complemental strand, 39671624 - 39671544
Alignment:
| Q |
111 |
atctcagaacatatcacaaaatgcaaatgagtctagtactccatttagtggaaatactcaactctcattagatgatatcaa |
191 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
39671624 |
atctcagaacatatctcaaaatgcaaatgagtccagtactccatttaatggaaatactcaactctcattggatgatatcaa |
39671544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 22 - 102
Target Start/End: Complemental strand, 39660929 - 39660848
Alignment:
| Q |
22 |
ttaacttttagtaatttttgtctttttgatttcaattctgtaatttgatacac-aacaatttccagtattaattatctttta |
102 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
39660929 |
ttaactattagtaatttttgtctgtttgatttcaattctgtaatttgatacacaaacaatttccagtattatttatctttta |
39660848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 39651438 - 39651330
Alignment:
| Q |
1 |
acctgatttcagcacaagttcttaacttttagtaatttttgtct-ttttgatttcaattctgtaatttgatacacaacaatttccagtattaattatctt |
99 |
Q |
| |
|
||||||||| |||||||||| ||||| ||| |||||||||||| |||| |||||| | || |||||||| | |||||||||||| | |||||||| || |
|
|
| T |
39651438 |
acctgatttaagcacaagttgctaactgttactaatttttgtctttttttatttcactcctttaatttga-atacaacaatttccgatgttaattatatt |
39651340 |
T |
 |
| Q |
100 |
ttattaattg |
109 |
Q |
| |
|
|||||||||| |
|
|
| T |
39651339 |
ttattaattg |
39651330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 73 - 104
Target Start/End: Complemental strand, 39660845 - 39660814
Alignment:
| Q |
73 |
acaacaatttccagtattaattatcttttatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39660845 |
acaacaatttccagtattaattatcttttatt |
39660814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University