View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16795_low_12 (Length: 239)
Name: NF16795_low_12
Description: NF16795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16795_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 32645443 - 32645221
Alignment:
| Q |
14 |
ctttctacattttgcaggtaaactaacgacccagtagttcgaccaataatttactgacctagtacttgatcgagcagaccaaggatccaattcttaaaac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32645443 |
ctttctacattttgcaggtaaactaacgacccagtagttcgaccaatgatttactgacctagtacttgatcgagcagaccaaggatccaattcttaaaac |
32645344 |
T |
 |
| Q |
114 |
acttaactaattaattaaagtatacgaccatgatgtttggtgtcatatgtggattattatttctaaattgtttgtgggaattttaatgcagtcgataacg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32645343 |
acttaactaattaattaaagtatacgaccatgatgtttggtgtcatatgtggattattatttctaaattgtttgttggaattttaatgcagtcgataacg |
32645244 |
T |
 |
| Q |
214 |
gtaaaaagatatccagctgagct |
236 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32645243 |
gtaaaaagatatccagctgagct |
32645221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University