View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16795_low_2 (Length: 421)
Name: NF16795_low_2
Description: NF16795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16795_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 2e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 144 - 404
Target Start/End: Complemental strand, 40565110 - 40564850
Alignment:
| Q |
144 |
ttttaaagaagataggtgaaattgacctgagttggacgcatggcggtttcaagagcagaaagacggtggtcaaaggaaccaagaatggtgacaacgttgt |
243 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40565110 |
ttttaaagaagaaaggtgaaattgacctgagttggacgcatggcggtttcaagagcagaaagacggtggtcaaaggaaccaagaatggtgacaacgttgt |
40565011 |
T |
 |
| Q |
244 |
ctgtaattgtttggcttttttgaagagactctctcatcatagctgcttttacactcagtgaatcagtaccacccattgctatacccannnnnnnnnnnnn |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40565010 |
ctgtaattgtttggcttttttgaagagactctctcatcatagctgcttttacgctcagtgaatcagtaccacccattgctatacccatcttcttcttctt |
40564911 |
T |
 |
| Q |
344 |
nnnnnntttagttgtttcagacaaagatgaacgaaatcacaagttattgaatttggtagca |
404 |
Q |
| |
|
| |||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
40564910 |
cttctttgtagttgtttcagacaaagatgaacaaaatcgcaagttattgaatttggtagca |
40564850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 168 - 268
Target Start/End: Original strand, 25290749 - 25290849
Alignment:
| Q |
168 |
acctgagttggacgcatggcggtttcaagagcagaaagacggtggtcaaaggaaccaagaatggtgacaacgttgtctgtaattgtttggcttttttgaa |
267 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||||||||||| || ||||| ||||||||||| | || | ||| || ||||| ||||||||||| |||| |
|
|
| T |
25290749 |
acctgagtaggacgcattgcggtttcaagcgcagaaagacgatgatcaaacgaaccaagaatcgaaaccatgttatcggtaatggtttggcttttgtgaa |
25290848 |
T |
 |
| Q |
268 |
g |
268 |
Q |
| |
|
| |
|
|
| T |
25290849 |
g |
25290849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University