View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16796_high_15 (Length: 397)
Name: NF16796_high_15
Description: NF16796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16796_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 19 - 389
Target Start/End: Complemental strand, 3945815 - 3945448
Alignment:
| Q |
19 |
aaaataccctccaccattgatacttctatttcttcttctccttcttcaactcctagttccacaccaaacaccacttcttcaaattcaaccttaaatcata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945815 |
aaaataccctccaccattgatacttctatttcttcttctccttc---aactcctagttccacaccaaacaccacttcttcaaattcaaccttaaatcata |
3945719 |
T |
|
| Q |
119 |
atattagtcctatgttttatggtttatcaagtagtaactcttgtgatgtgaatcttccattctcaaggttcaatatctctagactctcaacaagttcagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945718 |
atattagtcctatgttttatggtttatcaagtagtaactcttgtgatgtgaatcttccattctcaaggttcaatatctctagactctcaacaagttcagg |
3945619 |
T |
|
| Q |
219 |
ttatgattttcagcctcagatgaatactattggattaggcttttcatccgggtttacgtccagtgaagccaatgatcataatggttatacaaatggattt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945618 |
ttatgattttcagcctcagatgaatactattggattaggcttttcatctgggtttacgtccagtgaagccaatgatcataatggttatacaaatggattt |
3945519 |
T |
|
| Q |
319 |
acttcaagatatggttcaatctttagttcttcttctgtaccaagtaatgcatcagttatgccctctctgct |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3945518 |
acttcaagatatggttcaatctttagttcttcttctgtaccaagtaatgcatcagttatgccttctctgct |
3945448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University